pLV-Puro-CMV-EPB41L4A-AS1 unspliced-MUT- deltaSNORA13
(Plasmid
#242751)
-
PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePLV
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEPB41L4A-AS1
-
SpeciesH. sapiens (human)
-
MutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it resistant to ASO Deleteon of SNORNA13
-
GenBank IDNR_015370
-
Entrez GeneEPB41L4A-AS1 (a.k.a. C5orf26, NCRNA00219, TIGA1)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCCCATTGACGCAAATGGGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.04.08.647803 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-Puro-CMV-EPB41L4A-AS1 unspliced-MUT- deltaSNORA13 was a gift from Igor Ulitsky (Addgene plasmid # 242751 ; http://n2t.net/addgene:242751 ; RRID:Addgene_242751) -
For your References section:
EPB41L4A-AS1 long noncoding RNA acts in both cis- and trans-acting transcriptional regulation and controls nucleolar biology. Monziani A, Unfried JP, Cvetanovic T, Ulitsky I. bioRxiv 2025.04.08.647803 10.1101/2025.04.08.647803