pLIX-Bahcc1-HA_deltaBAH
(Plasmid
#242755)
-
PurposeExpresses Bahcc1 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLix402
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBahcc1
-
SpeciesM. musculus (mouse)
-
MutationDeletion of BAH domain
-
GenBank IDNM_198423
-
Entrez GeneBahcc1 (a.k.a. B930044J06)
- Promoter tight TRE promoter
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGAGAACGTATGTCGAGGTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.24.634719 for bioRxiv preprint.
Compared to GenBank ID NM_198423, Addgene NGS identifies A122P in Bahcc1. This mutation is present in a known variant: GenBank ID AK147250. The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIX-Bahcc1-HA_deltaBAH was a gift from Igor Ulitsky (Addgene plasmid # 242755 ; http://n2t.net/addgene:242755 ; RRID:Addgene_242755) -
For your References section:
BAHCC1 promotes gene expression in neuronal cells by antagonizing SIN3A-HDAC1. Monziani A, Perry RBT, Hezroni H, Ulitsky I. bioRxiv 2025.01.24.634719 10.1101/2025.01.24.634719