pET28(a)-p2c-Cas9
(Plasmid
#242759)
-
PurposeExpresses Cas9 nuclease with fused p2c targeting ligand for expression in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28(a)
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP2C-Cas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4425
- Promoter lac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGCAGCCCAGTAGTAGGTTGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28(a)-p2c-Cas9 was a gift from Jason Rasgon (Addgene plasmid # 242759 ; http://n2t.net/addgene:242759 ; RRID:Addgene_242759) -
For your References section:
Targeted delivery of CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritable germline gene editing. Chaverra-Rodriguez D, Macias VM, Hughes GL, Pujhari S, Suzuki Y, Peterson DR, Kim D, McKeand S, Rasgon JL. Nat Commun. 2018 Aug 1;9(1):3008. doi: 10.1038/s41467-018-05425-9. 10.1038/s41467-018-05425-9 PubMed 30068905