pHR-CD5-NbHA-mCherry
(Plasmid
#242817)
-
PurposeStable expression of NbHA-mCherry for secretion of fusion protein into the extracellular medium
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNbHA
-
Alt nameNanobody against IAV H1 protein
-
SpeciesL. glama (lama)
-
Insert Size (bp)414
- Promoter SFFV
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcccgagctctataaaagag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-CD5-NbHA-mCherry was a gift from Marvin Tanenbaum (Addgene plasmid # 242817 ; http://n2t.net/addgene:242817 ; RRID:Addgene_242817) -
For your References section:
Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity. Rabouw H, Schokolowski J, Müller M, Baars MJD, Dost AFM, Bestebroer TM, Püschel J, Clevers H, Fouchier RAM, Tanenbaum ME. Cell Systems, 2026; 17 10.1016/j.cels.2025.101489