Skip to main content

pET-28a_VIM-20
(Plasmid #242842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242842 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a(+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 6018
  • Modifications to backbone
    removed the Thrombin site and T7 tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Metallo-beta-lactamase VIM-20
  • Alt name
    VIM-20
  • Alt name
    Verona integron-encoded metallo-beta-lactamase 20
  • Alt name
    Verona imipenemase 20
  • Species
    Enterobacter cloacae
  • Insert Size (bp)
    789
  • Mutation
    deleted residues 1-26
  • GenBank ID
    MF678584 NG_050347
  • Promoter T7
  • Tag / Fusion Protein
    • His6 + Tobacco etch virus (TEV) cleavage site “ENLYFQ/G" (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a_VIM-20 was a gift from Richard Page (Addgene plasmid # 242842 ; http://n2t.net/addgene:242842 ; RRID:Addgene_242842)
  • For your References section:

    Mutation of an active site-adjacent residue in VIM indirectly dictates interactions with and blunts inhibition by D-captopril. Silwal SB, Wamsley B, Wang Z, Gung BW, Nix JC, Page RC. J Inorg Biochem. 2025 Oct;271:112975. doi: 10.1016/j.jinorgbio.2025.112975. Epub 2025 Jun 10. 10.1016/j.jinorgbio.2025.112975 PubMed 40513263