pET-28a_VIM-20
(Plasmid
#242842)
-
PurposeExpresses His6-TEV-VIM-20 in bacteria, comprising a His6-tag, the Tobacco etch virus (TEV) cleavage site “ENLYFQ/G", and the VIM-20 sequence (UniPROT A0A344X7M2)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 6018
-
Modifications to backboneremoved the Thrombin site and T7 tag
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMetallo-beta-lactamase VIM-20
-
Alt nameVIM-20
-
Alt nameVerona integron-encoded metallo-beta-lactamase 20
-
Alt nameVerona imipenemase 20
-
SpeciesEnterobacter cloacae
-
Insert Size (bp)789
-
Mutationdeleted residues 1-26
-
GenBank IDMF678584 NG_050347
- Promoter T7
-
Tag
/ Fusion Protein
- His6 + Tobacco etch virus (TEV) cleavage site “ENLYFQ/G" (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a_VIM-20 was a gift from Richard Page (Addgene plasmid # 242842 ; http://n2t.net/addgene:242842 ; RRID:Addgene_242842) -
For your References section:
Mutation of an active site-adjacent residue in VIM indirectly dictates interactions with and blunts inhibition by D-captopril. Silwal SB, Wamsley B, Wang Z, Gung BW, Nix JC, Page RC. J Inorg Biochem. 2025 Oct;271:112975. doi: 10.1016/j.jinorgbio.2025.112975. Epub 2025 Jun 10. 10.1016/j.jinorgbio.2025.112975 PubMed 40513263