Skip to main content

pLKO-U6-sgRXRa4-1; EF1a-mScarlet
(Plasmid #242889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242889 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    TRC
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 7996
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting Rxra
  • gRNA/shRNA sequence
    ggcagtccttgttgtctcggc
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_011305.3
  • Promoter U6
  • Tag / Fusion Protein
    • mScarlet (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer M13 forward
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Modified version made in the Fuchs lab from the TRC lentiviral shRNA knockdown vector, pLKO.1

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-U6-sgRXRa4-1; EF1a-mScarlet was a gift from Elaine Fuchs (Addgene plasmid # 242889 ; http://n2t.net/addgene:242889 ; RRID:Addgene_242889)
  • For your References section:

    Stem cells tightly regulate dead cell clearance to maintain tissue fitness. Stewart KS, Abdusselamoglu MD, Tierney MT, Gola A, Hur YH, Gonzales KAU, Yuan S, Bonny AR, Yang Y, Infarinato NR, Cowley CJ, Levorse JM, Pasolli HA, Ghosh S, Rothlin CV, Fuchs E. Nature. 2024 Sep;633(8029):407-416. doi: 10.1038/s41586-024-07855-6. Epub 2024 Aug 21. 10.1038/s41586-024-07855-6 PubMed 39169186