pLKO-U6-sgRXRa4-1; EF1a-mScarlet
(Plasmid
#242889)
-
PurposeFor lentiviral Crispr/Cas9 mediated knockout of mouse RXRa, using a guide RNA against exon 4, coupled to EF1a-driven mScarlet
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerTRC
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7996
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting Rxra
-
gRNA/shRNA sequenceggcagtccttgttgtctcggc
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_011305.3
- Promoter U6
-
Tag
/ Fusion Protein
- mScarlet (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer M13 forward
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byModified version made in the Fuchs lab from the TRC lentiviral shRNA knockdown vector, pLKO.1
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-U6-sgRXRa4-1; EF1a-mScarlet was a gift from Elaine Fuchs (Addgene plasmid # 242889 ; http://n2t.net/addgene:242889 ; RRID:Addgene_242889) -
For your References section:
Stem cells tightly regulate dead cell clearance to maintain tissue fitness. Stewart KS, Abdusselamoglu MD, Tierney MT, Gola A, Hur YH, Gonzales KAU, Yuan S, Bonny AR, Yang Y, Infarinato NR, Cowley CJ, Levorse JM, Pasolli HA, Ghosh S, Rothlin CV, Fuchs E. Nature. 2024 Sep;633(8029):407-416. doi: 10.1038/s41586-024-07855-6. Epub 2024 Aug 21. 10.1038/s41586-024-07855-6 PubMed 39169186