pV1210
(Plasmid
#242891)
-
PurposeModified plasmid from pV1200 to perform ENO1-SI CRISPR in Candidozyma auris
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepV1200
-
Backbone manufacturerValmik Vyas
- Total vector size (bp) 13113
-
Modifications to backboneReplaced C. albicans ENO1promoter, ENO1terminator and SNR52promoter with C. auris sequences
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions100µg/mL Ampicillin in LB medium or 50µg/mL Nourseothricin in LB medium for bacterial propagation.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCaCas9/sgRNA-BsmBI stuffer
-
gRNA/shRNA sequenceGGAGACGGAATTCCGTCTC - sgRNA-BsmBI stuffer
-
SpeciesSynthetic; Candida auris, Candida albicans, Streptococcus pyogenes
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAGGATTCTACGCGCATTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.09.632232 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pV1210 was a gift from Patrick Van Dijck (Addgene plasmid # 242891 ; http://n2t.net/addgene:242891 ; RRID:Addgene_242891) -
For your References section:
A comparative evaluation of CRISPR-Cas9 allele editing systems in Candida auris: challenging research in a challenging bug. Sofras D, Carolus H, Subotic A, Romero CL, Ennis CL, Hernday AD, Nobile CJ, Rybak JM, Van Dijck P. bioRxiv [Preprint]. 2025 Jan 11:2025.01.09.632232. doi: 10.1101/2025.01.09.632232. 10.1101/2025.01.09.632232 PubMed 39829791