PB_rtTA_BsmB-XRN2_sgRNA_1
(Plasmid
#242895)
-
PurposePiggyBac cargo vector with XRN2 sgRNA 1 for dox-inducible knockdown
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242895 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB_rtTA_BsmBI
-
Backbone manufacturerMauro Calabrese (Addgene plasmid # 126028)
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXRN2
-
gRNA/shRNA sequenceTGAATCAGCAGCGTTCAAGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneXrn2
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Knockdown validated by Western blot in Trophpblast Stem Cells
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB_rtTA_BsmB-XRN2_sgRNA_1 was a gift from Mauro Calabrese (Addgene plasmid # 242895 ; http://n2t.net/addgene:242895 ; RRID:Addgene_242895)