PB_rtTA_BsmB-HNRNPK_sgRNA_4
(Plasmid
#242899)
-
PurposePiggyBac cargo vector with HNRNPK sgRNA 4 for dox-inducible knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 242899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB_rtTA_BsmBI
-
Backbone manufacturerMauro Calabrese (Addgene plasmid # 126028)
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHNRNPK
-
gRNA/shRNA sequenceATGATGTTTGATGACCGCCG
-
SpeciesM. musculus (mouse)
-
Entrez GeneHnrnpk (a.k.a. Hnrpk, KBBP, NOVA)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Knockdown validated by Western blot in Trophpblast Stem Cells
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB_rtTA_BsmB-HNRNPK_sgRNA_4 was a gift from Mauro Calabrese (Addgene plasmid # 242899 ; http://n2t.net/addgene:242899 ; RRID:Addgene_242899) -
For your References section:
lncRNA-Induced Spread of Polycomb Controlled by Genome Architecture, RNA Abundance, and CpG Island DNA. Schertzer MD, Braceros KCA, Starmer J, Cherney RE, Lee DM, Salazar G, Justice M, Bischoff SR, Cowley DO, Ariel P, Zylka MJ, Dowen JM, Magnuson T, Calabrese JM. Mol Cell. 2019 Aug 8;75(3):523-537.e10. doi: 10.1016/j.molcel.2019.05.028. Epub 2019 Jun 27. 10.1016/j.molcel.2019.05.028 PubMed 31256989