pCK071
(Plasmid
#242907)
-
PurposeConstitutive expression of dCas9 and PspF-λN22
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 242907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCD442
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePspF-λN22
-
SpeciesSynthetic
-
Entrez GenepspF (a.k.a. b1303, ECK1298, ycjB)
- Promoter BBa_J23107
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACGCATTGATTTGAGTCAGC
- 3′ sequencing primer tcgtaagccatttccgctcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.14.654134 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK071 was a gift from Jesse Zalatan (Addgene plasmid # 242907 ; http://n2t.net/addgene:242907 ; RRID:Addgene_242907) -
For your References section:
Systematic Mapping of Bacterial CRISPRa Systems for Synergistic Gene Activation Reveals Antagonistic Effects. Kiattisewee C, Karanjia AV, Cardiff RAL, Olander KE, Leejareon P, Alvi SS, Carothers JM, Zalatan JG. ACS Synth Biol. 2025 Jul 22. doi: 10.1021/acssynbio.5c00358. 10.1021/acssynbio.5c00358 PubMed 40693287