pDL1-Spol-Ovo-C-term
(Plasmid
#242943)
-
PurposeEncodes a C-terminal fragment of Spol-Ovo for use in generating dsRNA for RNAi in the planarian S. polychroa
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242943 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDL1
-
Backbone manufacturerDaniel Lobo (Addgene plasmid # 182263)
- Backbone size w/o insert (bp) 2319
- Total vector size (bp) 2649
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpol-Ovo (Cterm fragment)
-
SpeciesSchmidtea polychroa
-
Insert Size (bp)455
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAAATGGTGGAGATGGAATAGT
- 3′ sequencing primer GGGTGCTCCTGAATGATGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pDL1 (empty vector) is available as Addgene #182263.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDL1-Spol-Ovo-C-term was a gift from Erin Davies (Addgene plasmid # 242943 ; http://n2t.net/addgene:242943 ; RRID:Addgene_242943) -
For your References section:
Protocol combining RNA interference and regeneration assays in planarian embryos. Deihl EW, Booth CLT, Davies EL. bioRxiv [Preprint]. 2025 Jul 22:2025.07.21.666018. doi: 10.1101/2025.07.21.666018. 10.1101/2025.07.21.666018 PubMed 40777484