Skip to main content
Addgene
Open Menu

pLKO.1 mTagBFP2 rat PYGB shRNA
(Plasmid #242946)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242946 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pLKO.1 - TRC mTagBFP2
  • Backbone size w/o insert (bp) 7073
  • Total vector size (bp) 7135
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PYGB shRNA
  • gRNA/shRNA sequence
    CCTGTATCCCAATGACAATTT
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Pygb (a.k.a. GLYPHOA)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 mTagBFP2 rat PYGB shRNA was a gift from Timothy Ryan (Addgene plasmid # 242946 ; http://n2t.net/addgene:242946 ; RRID:Addgene_242946)

  • For your References section:

    Neuromodulatory control of energy reserves in dopaminergic neurons. Pulido C, Gentry MS, Ryan TA. Proc Natl Acad Sci U S A. 2025 Dec 16;122(50):e2523019122. doi: 10.1073/pnas.2523019122. Epub 2025 Dec 5. 10.1073/pnas.2523019122 PubMed 41348744
Related items: