pRS313 Gal1p2
(Plasmid
#242948)
-
PurposeBackbone plasmid for IcsB and homologs subcloning
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS313
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBackbone plasmid for subcloning
-
SpeciesS. cerevisiae (budding yeast)
-
Tag
/ Fusion Protein
- 3X FLAG tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CCCTTTAGTGAGGGTTAATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS313 Gal1p2 was a gift from François-Xavier Campbell-Valois (Addgene plasmid # 242948 ; http://n2t.net/addgene:242948 ; RRID:Addgene_242948) -
For your References section:
A bacterial family of fatty acid acyltransferases related to the Shigella effector IcsB. Bajunaid W, Tomaro K, Kottarampatel AH, Desrochers GF, Lavallee-Adam M, Pezacki JP, Campbell-Valois F-X. mBio. 2026 Mar 17:e0389025. doi: 10.1128/mbio.03890-25. 10.1128/mbio.03890-25 PubMed 41841725