Skip to main content
Addgene
Open Menu

pRS313 Gal1p2
(Plasmid #242948)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242948 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pRS313
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Backbone plasmid for subcloning
  • Species
    S. cerevisiae (budding yeast)
  • Tag / Fusion Protein
    • 3X FLAG tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CCCTTTAGTGAGGGTTAATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS313 Gal1p2 was a gift from François-Xavier Campbell-Valois (Addgene plasmid # 242948 ; http://n2t.net/addgene:242948 ; RRID:Addgene_242948)

  • For your References section:

    A bacterial family of fatty acid acyltransferases related to the Shigella effector IcsB. Bajunaid W, Tomaro K, Kottarampatel AH, Desrochers GF, Lavallée-Adam M, Pezacki JP, Campbell-Valois F.. mBio 0:e03890-25 10.1128/mbio.03890-25
Related items: