pRS316 Gal1p1
(Plasmid
#242951)
-
PurposeBackbone plasmid for subcloning
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS316
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGal_promoter-cycE terminator
-
SpeciesS. cerevisiae (budding yeast)
-
Tag
/ Fusion Protein
- Myc-tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site TCTAGA (not destroyed)
- 3′ cloning site CTCGAG (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CCTCGACTGTGCCTTCTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS316 Gal1p1 was a gift from François-Xavier Campbell-Valois (Addgene plasmid # 242951 ; http://n2t.net/addgene:242951 ; RRID:Addgene_242951) -
For your References section:
A bacterial family of fatty acid acyltransferases related to the Shigella effector IcsB. Bajunaid W, Tomaro K, Kottarampatel AH, Desrochers GF, Lavallee-Adam M, Pezacki JP, Campbell-Valois F-X. mBio. 2026 Mar 17:e0389025. doi: 10.1128/mbio.03890-25. 10.1128/mbio.03890-25 PubMed 41841725