Skip to main content

pAG mIgG2a Anti-c-Myc [9E10]
(Plasmid #242955)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 242955 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pAG mIgG2a Empty
  • Backbone manufacturer
    Addgene Research Program (Addgene plasmid # 242953)
  • Total vector size (bp) 5294
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Anti-c-Myc [9E10] fused to mouse IgG2a heavy chain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1374
  • Promoter CMV
  • Tag / Fusion Protein
    • Mouse IgG2a (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggccctcgaggacgccagca
  • 3′ sequencing primer gcgcgcccaacagccccatc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG mIgG2a Anti-c-Myc [9E10] was a gift from Meghan Rego & Addgene Research Program (Addgene plasmid # 242955 ; http://n2t.net/addgene:242955 ; RRID:Addgene_242955)