pSBtet-FAP-TGN38-GFP
(Plasmid
#242992)
-
PurposeInducible FAP-TGN38-GFP expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBtet-puro
- Backbone size w/o insert (bp) 5581
- Total vector size (bp) 7429
-
Vector typeMammalian Expression ; Sleeping Beauty
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedH6.2-TGN38-GFP
-
Alt nameFAP-TGN38-GFP
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1848
-
Entrez GeneTgoln2 (a.k.a. Tgn38, Tgoln1, Ttgn1)
- Promoter Tight TRE
-
Tags
/ Fusion Proteins
- FAP (N terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCTGGAGCCAATTCCAACTC
- 3′ sequencing primer GTCTATCGATGGAAGCTTGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBtet-FAP-TGN38-GFP was a gift from Itay Budin (Addgene plasmid # 242992 ; http://n2t.net/addgene:242992 ; RRID:Addgene_242992) -
For your References section:
Leaflet-specific phospholipid imaging using genetically encoded proximity sensors. Moore WM, Brea RJ, Knittel C, Wrightsman E, Hui B, Lou J, Ancajas CF, Best MD, Obara, CJ Devaraj NK, Budin I. Nat Chem Biol (2025). https://doi.org/10.1038/s41589-025-02021-z. 10.1038/s41589-025-02021-z PubMed 38746395