pBH4-6хHIS-TEV-HP1α
(Plasmid
#243658)
-
PurposeFull-length human HP1α expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 243658 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBH4
- Total vector size (bp) 5986
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHP1a
-
SpeciesH. sapiens (human)
-
Entrez GeneCBX5 (a.k.a. HEL25, HP1, HP1A, HP1alpha)
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBH4-6хHIS-TEV-HP1α was a gift from Geeta Narlikar (Addgene plasmid # 243658 ; http://n2t.net/addgene:243658 ; RRID:Addgene_243658) -
For your References section:
Liquid droplet formation by HP1alpha suggests a role for phase separation in heterochromatin. Larson AG, Elnatan D, Keenen MM, Trnka MJ, Johnston JB, Burlingame AL, Agard DA, Redding S, Narlikar GJ. Nature. 2017 Jul 13;547(7662):236-240. doi: 10.1038/nature22822. Epub 2017 Jun 21. 10.1038/nature22822 PubMed 28636604