Skip to main content
Addgene
Open Menu

SHC003BSDDelGFP-hCCDC32-3xFLAG
(Plasmid #243757)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 243757 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    SHC003BSDDelGFP-3xFLAG
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Coiled-coil domain-containing protein 32
  • Species
    H. sapiens (human)
  • Entrez Gene
    CCDC32 (a.k.a. C15orf57, CFNDS)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3XFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SHC003BSDDelGFP-hCCDC32-3xFLAG was a gift from Jingshi Shen (Addgene plasmid # 243757 ; http://n2t.net/addgene:243757 ; RRID:Addgene_243757)

  • For your References section:

    An AAGAB-to-CCDC32 handover mechanism controls the assembly of the AP2 adaptor complex. Wan C, Puscher H, Ouyang Y, Wu J, Tian Y, Li S, Yin Q, Shen J. Proc Natl Acad Sci U S A. 2024 Aug 20;121(34):e2409341121. doi: 10.1073/pnas.2409341121. Epub 2024 Aug 15. 10.1073/pnas.2409341121 PubMed 39145939
Related items: