AAV-CAG-GFP
(Plasmid
#243759)
-
PurposeAAV plasmid expressing GFP under the CAG promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 243759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCIGW
-
Backbone manufacturerPamela McLean
- Backbone size w/o insert (bp) 6443
- Total vector size (bp) 7167
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEnhanced Green Fluorescent Protein
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter CAG
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAATTCTGCAGTCGACGCCACCATGGTGAGCAAGG
- 3′ sequencing primer GGATCCGGTACCGATATCTCATTACTTGTACAGCTCGTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-GFP was a gift from Andrew Arrant (Addgene plasmid # 243759 ; http://n2t.net/addgene:243759 ; RRID:Addgene_243759) -
For your References section:
TFEB overexpression alleviates autophagy-lysosomal deficits caused by progranulin insufficiency. Nader WO, Brown KS, Boyle NR, Kaplelach AK, Abdelaziz SM, Davis SE, Aljabi Q, Hakim AR, Davidson AG, Vollmer GA, Wright LC, Echols JB, Saad J, Pena NS, Arrant AE. Sci Rep. 2025 Jul 19;15(1):26217. doi: 10.1038/s41598-025-12268-0. 10.1038/s41598-025-12268-0 PubMed 40683940