AAV-CAG-GRN-HA
(Plasmid
#243760)
-
PurposeAAV plasmid expressing human GRN with a C-terminal HA tag under the CAG promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 243760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCIGW
-
Backbone manufacturerPamela McLean
- Backbone size w/o insert (bp) 6443
- Total vector size (bp) 8267
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProgranulin
-
Alt nameGRN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1824
-
GenBank IDNM_002087
-
Entrez GeneGRN (a.k.a. CLN11, FTD2, GEP, GP88, PCDGF, PEPI, PGRN)
- Promoter CAG
-
Tag
/ Fusion Protein
- HA Tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAATTCTGCAGTCGAGCCACCATGTGGACCCTG
- 3′ sequencing primer GGATCCGGTACCGATTTAAGCGTAATCTGGAACATCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOrigene construct SKU RC202139
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-GRN-HA was a gift from Andrew Arrant (Addgene plasmid # 243760 ; http://n2t.net/addgene:243760 ; RRID:Addgene_243760) -
For your References section:
TFEB overexpression alleviates autophagy-lysosomal deficits caused by progranulin insufficiency. Nader WO, Brown KS, Boyle NR, Kaplelach AK, Abdelaziz SM, Davis SE, Aljabi Q, Hakim AR, Davidson AG, Vollmer GA, Wright LC, Echols JB, Saad J, Pena NS, Arrant AE. Sci Rep. 2025 Jul 19;15(1):26217. doi: 10.1038/s41598-025-12268-0. 10.1038/s41598-025-12268-0 PubMed 40683940