ptetgRNA-FRT
(Plasmid
#243872)
-
PurposesgRNA expression vector under tetR transcriptional control.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 243872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepgRNA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA_FRT
-
gRNA/shRNA sequenceTCCTATACTTTCTAGAGAAT
-
SpeciesSynthetic
-
Insert Size (bp)20
Cloning Information
- Cloning method Other
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypKDsgRNA-FRT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptetgRNA-FRT was a gift from Christophe Herman (Addgene plasmid # 243872 ; http://n2t.net/addgene:243872 ; RRID:Addgene_243872) -
For your References section:
GoldenBraid2.0 E. coli: a comprehensive and characterized toolkit for enterics. Cooke MB, Welch KT, Ramirez LD, Wen AX, Marciano DC, Herman C. Synth Biol (Oxf). 2025 Aug 14;10(1):ysaf015. doi: 10.1093/synbio/ysaf015. eCollection 2025. 10.1093/synbio/ysaf015 PubMed 40927394