pUC-GW-Kan-VPC
(Plasmid
#244163)
-
PurposeReporter for human p38alpha activation state by FRET
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57--GW-Kan
-
Backbone manufacturerGenewiz
- Backbone size w/o insert (bp) 2871
- Total vector size (bp) 6024
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersJust Kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAPK14/p38a
-
Alt nameMAPK
-
Alt namep38a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1080
-
GenBank IDL35263.1 NM_001315
-
Entrez GeneMAPK14 (a.k.a. CSBP, CSBP1, CSBP2, CSPB1, EXIP, Mxi2, PRKM14, PRKM15, RK, SAPK2A, p38, p38ALPHA)
- Promoter CMV promoter
-
Tags
/ Fusion Proteins
- mVenus (N terminal on insert)
- mCerulean3 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taatacgactcactatagagg
- 3′ sequencing primer aactggttcttctctacctcagg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC-GW-Kan-VPC was a gift from Thomas Kuhlman (Addgene plasmid # 244163 ; http://n2t.net/addgene:244163 ; RRID:Addgene_244163)