Skip to main content

pX330_mouseH3.1
(Plasmid #244241)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 244241 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Feng Zhang lab (Addgene plasmid # 42230)
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8520
  • Modifications to backbone
    We inserted the sgRNA coding sequence targeting mouse H3.1 (H3c1) into the BbsI restriction site
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting mouse histone H3.1
  • Alt name
    Hist1h3a
  • gRNA/shRNA sequence
    ACAATTACGCCCTCTCCCCG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    H3c1 (a.k.a. H3c10, H3c11, H3c8, Hist1h3a)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_mouseH3.1 was a gift from Kazuhiro Maeshima (Addgene plasmid # 244241 ; http://n2t.net/addgene:244241 ; RRID:Addgene_244241)
  • For your References section:

    Replication-dependent histone labeling dissects the physical properties of euchromatin/heterochromatin in living human cells. Minami K, Nakazato K, Ide S, Kaizu K, Higashi K, Tamura S, Toyoda A, Takahashi K, Kurokawa K, Maeshima K. Sci Adv. 2025 Mar 28;11(13):eadu8400. doi: 10.1126/sciadv.adu8400. Epub 2025 Mar 28. 10.1126/sciadv.adu8400 PubMed 40153514