pX330_mouseH3.1
(Plasmid
#244241)
-
PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang lab (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 8520
-
Modifications to backboneWe inserted the sgRNA coding sequence targeting mouse H3.1 (H3c1) into the BbsI restriction site
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting mouse histone H3.1
-
Alt nameHist1h3a
-
gRNA/shRNA sequenceACAATTACGCCCTCTCCCCG
-
SpeciesM. musculus (mouse)
-
Entrez GeneH3c1 (a.k.a. H3c10, H3c11, H3c8, Hist1h3a)
- Promoter U6
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TRC-F
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_mouseH3.1 was a gift from Kazuhiro Maeshima (Addgene plasmid # 244241 ; http://n2t.net/addgene:244241 ; RRID:Addgene_244241) -
For your References section:
Replication-dependent histone labeling dissects the physical properties of euchromatin/heterochromatin in living human cells. Minami K, Nakazato K, Ide S, Kaizu K, Higashi K, Tamura S, Toyoda A, Takahashi K, Kurokawa K, Maeshima K. Sci Adv. 2025 Mar 28;11(13):eadu8400. doi: 10.1126/sciadv.adu8400. Epub 2025 Mar 28. 10.1126/sciadv.adu8400 PubMed 40153514