Skip to main content
Addgene
Open Menu

pX330_CDC45
(Plasmid #244243)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 244243 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Feng Zhang lab (Addgene plasmid # 42230)
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8520
  • Modifications to backbone
    We inserted the sgRNA coding sequence targeting human CDC45 into the BbsI restriction site
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human CDC45
  • Alt name
    Cdc45
  • gRNA/shRNA sequence
    GAACCCCTGTAACTCACCCT
  • Species
    H. sapiens (human)
  • Entrez Gene
    CDC45 (a.k.a. CDC45L, CDC45L2, MGORS7, PORC-PI-1)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_CDC45 was a gift from Kazuhiro Maeshima (Addgene plasmid # 244243 ; http://n2t.net/addgene:244243 ; RRID:Addgene_244243)

  • For your References section:

    Replication-dependent histone labeling dissects the physical properties of euchromatin/heterochromatin in living human cells. Minami K, Nakazato K, Ide S, Kaizu K, Higashi K, Tamura S, Toyoda A, Takahashi K, Kurokawa K, Maeshima K. Sci Adv. 2025 Mar 28;11(13):eadu8400. doi: 10.1126/sciadv.adu8400. Epub 2025 Mar 28. 10.1126/sciadv.adu8400 PubMed 40153514
Related items: