TaHKT1_pYES2
(Plasmid
#244447)
-
PurposeHigh-copy episomal vector for galactose-inducible expression of TaHKT1 protein in Saccharomyces cerevisiae.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYES2
- Backbone size w/o insert (bp) 5971
- Total vector size (bp) 8002
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTaHKT1
-
SpeciesTriticum aestivum
-
Insert Size (bp)2031
- Promoter T7 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TaHKT1_pYES2 was a gift from Julian Schroeder (Addgene plasmid # 244447 ; http://n2t.net/addgene:244447 ; RRID:Addgene_244447) -
For your References section:
Structure and transport mechanism of a high-affinity potassium uptake transporter from higher plants. Schachtman DP, Schroeder JI. Nature. 1994 Aug 25;370(6491):655-8. doi: 10.1038/370655a0. 10.1038/370655a0 PubMed 8065452