pL0M-PU-pLsUBI
(Plasmid
#244448)
-
PurposeLevel 0 Golden Gate "PU" module containing the domesticated sequence of the promoter of the polyubiquitin 4 gene (LOC111919935) from lettuce (Lactuca sativa)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEC41295
- Backbone size w/o insert (bp) 2845
- Total vector size (bp) 4159
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDomesticated sequence of the promoter for the polyubiquitin 4 gene (LOC111919935) from lettuce (Lactuca sativa)
-
Alt nameLsUBI Promoter
-
SpeciesLactuca sativa
-
Insert Size (bp)1408
-
MutationThe promoter sequence 96336283-96337681 from NC_056626.2 was changed at position 96336319(A to T), position 96337481 (G to C) and 96337673 (G to A)
-
GenBank IDNC_056626
- Promoter Polyubiquitin 4 gene (LOC111919935) from lettuce
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGGTTTTTCAGTGACCTCTCTAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCloned by Lien Bertier, UC Davis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Discrepancies in the LsUBI Promoter were found that do not affect the plasmid's function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL0M-PU-pLsUBI was a gift from Beth Rowan (Addgene plasmid # 244448 ; http://n2t.net/addgene:244448 ; RRID:Addgene_244448)