pLKO.1C-YFP-shRB1-733
              
              
                (Plasmid
                
                #244458)
              
            
            
            
          - 
            PurposeExpresses EYFP and an shRNA against RB1 in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLKO.1C
- 
              Vector typeLentiviral
- 
                Selectable markersYFP
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameshRB1
- 
                    gRNA/shRNA sequencetttggactagaaataatgtgg
- 
                    SpeciesH. sapiens (human)
- 
                        Entrez GeneRB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TRC-F (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLKO.1C-YFP-shRB1-733 was a gift from David Cobrinik (Addgene plasmid # 244458 ; http://n2t.net/addgene:244458 ; RRID:Addgene_244458)
- 
                For your References section: Improved third-generation lentiviral packaging with pLKO.1C vectors. Lee S, Cobrinik D. Biotechniques. 2020 Jun;68(6):349-352. doi: 10.2144/btn-2019-0155. Epub 2020 Mar 6. 10.2144/btn-2019-0155 PubMed 32141762
 
    
 
                         
             
            