DoS2
(Plasmid
#244467)
-
PurposeContaining RP4 oriT, RP4 inc and I-SceI enzyme sequence, for eliminating RP4 plasmid and self-cutting.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneR+ from A. J. Lopatkin, et al., Antibiotics as a selective driver for conjugation dynamics. Nat. Microbiol. 1, 16044 (2016)
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameI-SceI enzyme
-
SpeciesSynthetic
-
Insert Size (bp)708
-
Entrez GeneCSS3 (a.k.a. YOL159C)
- Promoter tetR/tetA promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgttatcccctgattctgtggataacc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DoS2 was a gift from Lingchong You (Addgene plasmid # 244467 ; http://n2t.net/addgene:244467 ; RRID:Addgene_244467) -
For your References section:
A predatory gene drive for targeted control of self-transmissible plasmids. Tsoi R, Son HI, Hamrick GS, Tang K, Bethke JH, Lu J, Maddamsetti R, You L. Sci Adv. 2025 Apr 4;11(14):eads4735. doi: 10.1126/sciadv.ads4735. Epub 2025 Apr 2. 10.1126/sciadv.ads4735 PubMed 40173243