AtHKT1_pYES2
(Plasmid
#244550)
-
PurposeHigh- copy episomal vector for galactose-inducible expression of AtHKT1 protein in Saccharomyces cerevisiae.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYES2
- Backbone size w/o insert (bp) 5971
- Total vector size (bp) 7677
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtHKT1
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1518
-
Entrez GeneHKT1 (a.k.a. AT4G10310, ATHKT1, HKT1;1, T9A4.5, high-affinity K+ transporter 1)
- Promoter T7 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AtHKT1_pYES2 was a gift from Julian Schroeder (Addgene plasmid # 244550 ; http://n2t.net/addgene:244550 ; RRID:Addgene_244550) -
For your References section:
The Arabidopsis HKT1 gene homolog mediates inward Na(+) currents in xenopus laevis oocytes and Na(+) uptake in Saccharomyces cerevisiae. Uozumi N, Kim EJ, Rubio F, Yamaguchi T, Muto S, Tsuboi A, Bakker EP, Nakamura T, Schroeder JI. Plant Physiol. 2000 Apr;122(4):1249-59. doi: 10.1104/pp.122.4.1249. 10.1104/pp.122.4.1249 PubMed 10759522