pKMW306_U6-sgRNA-EMX1
(Plasmid
#244824)
-
PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 244824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX458
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyCas9 single guide RNA
-
gRNA/shRNA sequenceGAGTCCGAGCAGAAGAAGAA
-
SpeciesStreptococcus pyogenes
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKMW306_U6-sgRNA-EMX1 was a gift from Jennifer Doudna (Addgene plasmid # 244824 ; http://n2t.net/addgene:244824 ; RRID:Addgene_244824) -
For your References section:
Rapid two-step target capture ensures efficient CRISPR-Cas9-guided genome editing. Shi H, Al-Sayyad N, Wasko KM, Trinidad MI, Doherty EE, Vohra K, Boger RS, Colognori D, Cofsky JC, Skopintsev P, Bryant Z, Doudna JA. Mol Cell. 2025 May 1;85(9):1730-1742.e9. doi: 10.1016/j.molcel.2025.03.024. Epub 2025 Apr 23. 10.1016/j.molcel.2025.03.024 PubMed 40273916