Skip to main content

pKMW306_U6-sgRNA-EMX1
(Plasmid #244824)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 244824 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX458
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpyCas9 single guide RNA
  • gRNA/shRNA sequence
    GAGTCCGAGCAGAAGAAGAA
  • Species
    Streptococcus pyogenes
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKMW306_U6-sgRNA-EMX1 was a gift from Jennifer Doudna (Addgene plasmid # 244824 ; http://n2t.net/addgene:244824 ; RRID:Addgene_244824)
  • For your References section:

    Rapid two-step target capture ensures efficient CRISPR-Cas9-guided genome editing. Shi H, Al-Sayyad N, Wasko KM, Trinidad MI, Doherty EE, Vohra K, Boger RS, Colognori D, Cofsky JC, Skopintsev P, Bryant Z, Doudna JA. Mol Cell. 2025 May 1;85(9):1730-1742.e9. doi: 10.1016/j.molcel.2025.03.024. Epub 2025 Apr 23. 10.1016/j.molcel.2025.03.024 PubMed 40273916