Skip to main content

pLentiCRISPR IMMP1L sg1
(Plasmid #244849)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 244849 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2 puro
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IMMP1L sgRNA
  • gRNA/shRNA sequence
    ATACGTTGGTGGTGTTGTCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    IMMP1L (a.k.a. IMMP1, IMP1, IMP1-LIKE)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Integrated DNA Technologies

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPR IMMP1L sg1 was a gift from Alexis Jourdain (Addgene plasmid # 244849 ; http://n2t.net/addgene:244849 ; RRID:Addgene_244849)
  • For your References section:

    An updated inventory of genes essential for oxidative phosphorylation identifies a mitochondrial origin in familial Meniere's disease. Harhai M, Foged MM, Zarges C, Landoni JC, Chollet S, Simonelli M, Recazens E, Lisci M, Laban N, Manley S, Riemer J, Lopez-Escamez JA, Lysakowski A, Jourdain AA. Cell Rep. 2025 Jul 25;44(8):116069. doi: 10.1016/j.celrep.2025.116069. 10.1016/j.celrep.2025.116069 PubMed 40714634