pLentiCRISPR V2 UROS_sg2
(Plasmid
#244874)
-
PurposeKnockout of human UROS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 244874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2 puro
-
Backbone manufacturerFeng Zhang (Addgene #52961)
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUROS sgRNA
-
gRNA/shRNA sequenceTATCAGACAGTTGCACACCC
-
SpeciesH. sapiens (human)
-
Entrez GeneUROS (a.k.a. UROIIIS)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIntegrated DNA Technologies
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR V2 UROS_sg2 was a gift from Alexis Jourdain (Addgene plasmid # 244874 ; http://n2t.net/addgene:244874 ; RRID:Addgene_244874) -
For your References section:
An updated inventory of genes essential for oxidative phosphorylation identifies a mitochondrial origin in familial Meniere's disease. Harhai M, Foged MM, Zarges C, Landoni JC, Chollet S, Simonelli M, Recazens E, Lisci M, Laban N, Manley S, Riemer J, Lopez-Escamez JA, Lysakowski A, Jourdain AA. Cell Rep. 2025 Jul 25;44(8):116069. doi: 10.1016/j.celrep.2025.116069. 10.1016/j.celrep.2025.116069 PubMed 40714634