pU6-BbsI-EGFR
              
              
                (Plasmid
                
                #244932)
              
            
            
            
          - 
            PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepU6-BbsI-chiRNA (Addgene #45946)
- 
              Vector typeCRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namegRNA targeting EGFR C terminus
- 
                    gRNA/shRNA sequenceGAAACCGCAACACGGAGACG
- 
                    SpeciesSynthetic
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pU6-BbsI-EGFR was a gift from Jared Toettcher (Addgene plasmid # 244932 ; http://n2t.net/addgene:244932 ; RRID:Addgene_244932)
- 
                For your References section: A live-cell biosensor of in vivo receptor tyrosine kinase activity reveals feedback regulation of a developmental gradient. Ho EK, Kim-Yip RP, Simpkins AG, Farahani PE, Oatman HR, Posfai E, Shvartsman SY, Toettcher JE. Cell Rep. 2025 Jul 22;44(7):115930. doi: 10.1016/j.celrep.2025.115930. Epub 2025 Jun 27. 10.1016/j.celrep.2025.115930 PubMed 40581929
