Skip to main content

pRRL_CMVp-EGFP
(Plasmid #244970)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 244970 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRL
  • Total vector size (bp) 7478
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CMVp-EGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1347
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tatcgatcacgagactagccatagtaatcaattacggggtcattagttcatagc
  • 3′ sequencing primer ctcaccatggtggcgatatctccttcgaagcctgcttttttgtacaaacttgt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pLX304 vector containing CMV promoter was a gift from Alice Y. Ting (Stanford University) and this was for amplification of CMV

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL_CMVp-EGFP was a gift from Xinnan Wang (Addgene plasmid # 244970 ; http://n2t.net/addgene:244970 ; RRID:Addgene_244970)
  • For your References section:

    Human stem cell-specific epigenetic signatures control transgene expression. Kwak CS, Oflaz FE, Qiu J, Wang X. Biochim Biophys Acta Gene Regul Mech. 2024 Dec;1867(4):195063. doi: 10.1016/j.bbagrm.2024.195063. Epub 2024 Oct 20. 10.1016/j.bbagrm.2024.195063 PubMed 39437851