pRRL_miniUCOE-SFFVp-EGFP
(Plasmid
#244972)
-
PurposeExpress EGFP under miniUCOE-SFFV promoter. Xho I-miniUCOE-SFFVp-AgeI-EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRL
- Total vector size (bp) 7950
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameminiUCOE-SFFVp-EGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1822
- Promoter SFFV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atcgatcacgagactagcccgggaggtggtccctgc
- 3′ sequencing primer ctcaccatggtggcgacccgggcgactcagtctg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypKDP020 vector containing minimal UCOE was a gift from Alice Y. Ting (Stanford University) and this was for amplification of miniUCOE region.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL_miniUCOE-SFFVp-EGFP was a gift from Xinnan Wang (Addgene plasmid # 244972 ; http://n2t.net/addgene:244972 ; RRID:Addgene_244972) -
For your References section:
Human stem cell-specific epigenetic signatures control transgene expression. Kwak CS, Oflaz FE, Qiu J, Wang X. Biochim Biophys Acta Gene Regul Mech. 2024 Dec;1867(4):195063. doi: 10.1016/j.bbagrm.2024.195063. Epub 2024 Oct 20. 10.1016/j.bbagrm.2024.195063 PubMed 39437851