Skip to main content

pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
(Plasmid #245063)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 245063 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 5926
  • Vector type
    AAV, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry
  • gRNA/shRNA sequence
    GGCAACGTGCTGGTTATTATCG
  • Species
    M. musculus (mouse), Synthetic
  • Entrez Gene
    Adra2a (a.k.a. Adra-2, Adra-2a, alpha(2A)AR, alpha2-C10, alpha2A, alpha2A-AR)
  • Promoter human synapsin

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The adra2a shRNA hairpin sequence was placed into the mir30 site of pPRIME (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry was a gift from William Wisden (Addgene plasmid # 245063 ; http://n2t.net/addgene:245063 ; RRID:Addgene_245063)