pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
(Plasmid #245063)

• Purpose: AAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.
• Depositing Lab: William Wisden
• Publication: Knockdown of adra2a receptors cell type selectively (unpublished)

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 5926
• Vector type: AAV, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry
• gRNA/shRNA sequence: GGCAACGTGCTGGTTATTATCG
• Species: M. musculus (mouse), Synthetic
• Entrez Gene: Adra2a (a.k.a. Adra-2, Adra-2a, alpha(2A)AR, alpha2-C10, alpha2A, alpha2A-AR)
• Promoter: human synapsin

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: cacgcgaggcgcgagatag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The adra2a shRNA hairpin sequence was placed into the mir30 site of pPRIME (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry