pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
(Plasmid
#245063)
-
PurposeAAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 5926
-
Vector typeAAV, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry
-
gRNA/shRNA sequenceGGCAACGTGCTGGTTATTATCG
-
SpeciesM. musculus (mouse), Synthetic
-
Entrez GeneAdra2a (a.k.a. Adra-2, Adra-2a, alpha(2A)AR, alpha2-C10, alpha2A, alpha2A-AR)
- Promoter human synapsin
Cloning Information
- Cloning method Other
- 5′ sequencing primer cacgcgaggcgcgagatag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe adra2a shRNA hairpin sequence was placed into the mir30 site of pPRIME (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry was a gift from William Wisden (Addgene plasmid # 245063 ; http://n2t.net/addgene:245063 ; RRID:Addgene_245063)