pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
(Plasmid #245063)

• Purpose: AAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.
• Depositing Lab: William Wisden
• Publication: Anuncibay Soto et al Proc Natl Acad Sci U S A. 2025 Oct 14;122(41):e2422878122. doi: 10.1073/pnas.2422878122. Epub 2025 Oct 7.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 5926
• Vector type: AAV, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry
• gRNA/shRNA sequence: GGCAACGTGCTGGTTATTATCG
• Species: M. musculus (mouse), Synthetic
• Entrez Gene: Adra2a (a.k.a. Adra-2, Adra-2a, alpha(2A)AR, alpha2-C10, alpha2A, alpha2A-AR)
• Promoter: human synapsin

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: cacgcgaggcgcgagatag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The adra2a shRNA hairpin sequence was placed into the mir30 site of pPRIME (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry