Skip to main content

pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
(Plasmid #245063)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 245063 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 5926
  • Vector type
    AAV, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry
  • gRNA/shRNA sequence
    GGCAACGTGCTGGTTATTATCG
  • Species
    M. musculus (mouse), Synthetic
  • Entrez Gene
    Adra2a (a.k.a. Adra-2, Adra-2a, alpha(2A)AR, alpha2-C10, alpha2A, alpha2A-AR)
  • Promoter human synapsin

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The adra2a shRNA hairpin sequence was placed into the mir30 site of pPRIME (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry was a gift from William Wisden (Addgene plasmid # 245063 ; http://n2t.net/addgene:245063 ; RRID:Addgene_245063)
  • For your References section:

    The locus coeruleus maintains core body temperature and protects against hypothermia during dexmedetomidine-induced sedation. Anuncibay Soto B, Ma Y, Nollet M, Wong S, Miracca G, Rastinejad D, Yustos R, Vyssotski AL, Franks NP, Wisden W. Proc Natl Acad Sci U S A. 2025 Oct 14;122(41):e2422878122. doi: 10.1073/pnas.2422878122. Epub 2025 Oct 7. 10.1073/pnas.2422878122 PubMed 41055995