E pCMV-CFPLoxP-YFPatt
(Plasmid
#24509)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6724
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsccdB resistance E. Coli like Invitrogen’s One Shot® ccdB Survival™-T1R Chemically Competent Cells
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameECFP, EYFP
-
Alt nameCFP, YFP
-
SpeciesVibrio fischeri
-
Insert Size (bp)757
-
GenBank IDP21578
-
Tags
/ Fusion Proteins
- ECFP (C terminal on backbone)
- EYFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site clonase (destroyed during cloning)
- 3′ cloning site recombinase (destroyed during cloning)
- 5′ sequencing primer E LoxP-Rcmb GGCCTCGTACTACGCCTATT
- 3′ sequencing primer TCCGGATGAGCATTCATCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by1. He, L. et al. Flow cytometric measurement of fluorescence (Forster) resonance energy transfer from cyan fluorescent protein to yellow fluorescent protein using single-laser excitation at 458 nm. Cytometry A. 53, 39-54 (2003).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: This plasmid has been partially sequenced. Due to the presence of repeated features in the plasmid that prohibit thorough sequencing, the provided sequence should be considered theoretical and could contain errors.
Please refer to Lu, Jian-Ping, Beatty, Laura, and Pinthus, Jehonathan . Dual expression recombinase based (DERB) single vector system for high throughput screening and verification of protein interactions in living cells. Available from Nature Precedings
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E pCMV-CFPLoxP-YFPatt was a gift from Jehonathan Pinthus (Addgene plasmid # 24509 ; http://n2t.net/addgene:24509 ; RRID:Addgene_24509) -
For your References section:
Dual expression recombinase based (DERB) single vector system for high throughput screening and verification of protein interactions in living cells. Lu J, Beatty L, Pinthus J. Nat Prec (2008). 10.1038/npre.2008.1550.1