pFB-EF1a-DIO-Rpl22l1-3xFLAG-2A-GFP
(Plasmid
#245377)
-
PurposeCre-dependent expression of FLAG-tagged Rpl22l1 and EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFB
-
Backbone manufacturerVirovek
- Backbone size w/o insert (bp) 4544
- Total vector size (bp) 8507
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRpl22l1
-
Alt nameRibosomal protein L22-like1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3963
-
GenBank IDNM_001347226.3
-
Entrez GeneRpl22l1 (a.k.a. 3110001N18Rik)
- Promoter EF1a
-
Tag
/ Fusion Protein
- 3xFLAG, T2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCAGCTTGGTTCCCAATAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-EF1a-DIO-Rpl22l1-3xFLAG-2A-GFP was a gift from D. James Surmeier (Addgene plasmid # 245377 ; http://n2t.net/addgene:245377 ; RRID:Addgene_245377) -
For your References section:
alpha-Synuclein pathology disrupts mitochondrial function in dopaminergic and cholinergic neurons at-risk in Parkinson's disease. Geibl FF, Henrich MT, Xie Z, Zampese E, Ueda J, Tkatch T, Wokosin DL, Nasiri E, Grotmann CA, Dawson VL, Dawson TM, Chandel NS, Oertel WH, Surmeier DJ. Mol Neurodegener. 2024 Oct 8;19(1):69. doi: 10.1186/s13024-024-00756-2. 10.1186/s13024-024-00756-2 PubMed 39379975