pR2B5
(Plasmid #245486)

• Purpose: pL1-R2-pAtUBI-RUBY-tRBCS (Golden Gate Level 1 module with a transcription unit expressing RUBY from the AtUBI promoter with the tRBC terminator for R2 position in Level 2 vector)
• Depositing Lab: Beth Rowan
• Publication: Monitoring the stability of transgene expression in lettuce using the RUBY reporter. (unpublished)

Backbone

• Vector backbone: pICH47811
• Backbone manufacturer: Sylvestre Marillonet
• Backbone size w/o insert (bp): 4968
• Total vector size (bp): 10493
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: pAtUBI-RUBY-tRBCS
• Insert Size (bp): 6117
• Promoter: Polyubiquitin 10 gene from Arabidopsis thaliana

Cloning Information

• Cloning method: Golden Gate
• 5′ sequencing primer: gacgtcgttgtggttggtgc

Resource Information

• Supplemental Documents:
  • pR2B5.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry