pR2B5
(Plasmid
#245486)
-
PurposepL1-R2-pAtUBI-RUBY-tRBCS (Golden Gate Level 1 module with a transcription unit expressing RUBY from the AtUBI promoter with the tRBC terminator for R2 position in Level 2 vector)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47811
-
Backbone manufacturerSylvestre Marillonet
- Backbone size w/o insert (bp) 4968
- Total vector size (bp) 10493
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepAtUBI-RUBY-tRBCS
-
Insert Size (bp)6117
- Promoter Polyubiquitin 10 gene from Arabidopsis thaliana
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer gacgtcgttgtggttggtgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR2B5 was a gift from Beth Rowan (Addgene plasmid # 245486 ; http://n2t.net/addgene:245486 ; RRID:Addgene_245486)