pLSUBR
(Plasmid
#245489)
-
PurposeBinary Plasmid for plant transformation expressing RUBY from the Lactuca sativa polyubiquitin 4 gene promoter and the terminator from the same gene. Kanamycin plant selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245489 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAGM4273
-
Backbone manufacturerSylvestre Marillonet
- Backbone size w/o insert (bp) 12773
- Total vector size (bp) 12559
-
Vector typePlant Expression
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepLsUBI-RUBY-tLSUBI
-
Insert Size (bp)6440
- Promoter Polyubiquitin 4 gene (LOC111919935) from lettuce
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGGTTTTTCAGTGACCTCTCTAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSUBR was a gift from Beth Rowan (Addgene plasmid # 245489 ; http://n2t.net/addgene:245489 ; RRID:Addgene_245489)