frq[mNG_Flag]_hph
(Plasmid
#245515)
-
PurposeEndogenous C-terminal tag the circadian clock negative arm component FRQ with condon-optimized mNeonGreen and Flag tag.
-
Depositing Lab
-
Depositing OrganizationDartmouth College and Medical School
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRS426
- Total vector size (bp) 10742
-
Vector typeNeurospora Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefrq
-
Alt nameNCU02265
-
SpeciesNeurospora crassa
-
Insert Size (bp)4734
-
GenBank IDXM_011396823
-
Tags
/ Fusion Proteins
- mNeonGreen (C terminal on insert)
- Flag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gGACAACGCAACAACGGAG
- 3′ sequencing primer cgagctcgttgtttacgtaggtagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
frq[mNG_Flag]_hph was a gift from Jay C Dunlap (Addgene plasmid # 245515 ; http://n2t.net/addgene:245515 ; RRID:Addgene_245515) -
For your References section:
Core clock protein subcellular dynamics coordinate local and global circadian control in syncytia. Wang Z, Bartholomai BM, Wang B, Ritz D, Schultz D, Loros JJ, Dunlap JC. J Cell Biol. 2026 Jun 1;225(6):e202509044. doi: 10.1083/jcb.202509044. Epub 2026 May 19. 10.1083/jcb.202509044 PubMed 42154498