bRA66-deltaMic60
(Plasmid
#245524)
-
PurposeEdited bRA66 containing gRNA to create S. cerevisiae deltaMic60 and S. cerevisiae Mic60(1-317)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonebRA66
-
Backbone manufacturerAddgene Plasmid #100952
- Backbone size w/o insert (bp) 10931
- Total vector size (bp) 10951
-
Modifications to backboneinserted gRNA AGATTCTTGACTGTGAAATA
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYKR016w
-
gRNA/shRNA sequenceCTACGCTTAATAGCGATGGA
-
SpeciesS. cerevisiae (budding yeast)
-
GenBank IDZ28241.1 Z28241.1
-
Entrez GeneMIC60 (a.k.a. YKR016W, AIM28, FCJ1, FMP13)
- Promoter T7 TAATACGACTCACTATAGG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer GTCATAGCTGTTTCCTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bybRA66 was obtained from Addgene from James Haber (Addgene plasmid # 100952 ; http://n2t.net/addgene:100952 ; RRID:Addgene_100952; Anand et al., 2017)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bRA66-deltaMic60 was a gift from Luke Chao (Addgene plasmid # 245524 ; http://n2t.net/addgene:245524 ; RRID:Addgene_245524) -
For your References section:
Ancestral sequence reconstruction of the Mic60 Mitofilin domain reveals residues supporting respiration in yeast. Benning FMC, Bell TA, Nguyen TH, Syau D, Connell LB, Liao YT, Keating MP, Coughlin M, Nordstrom AEH, Ericsson M, daCosta CJB, Chao LH. Protein Sci. 2025 Jul;34(7):e70207. doi: 10.1002/pro.70207. 10.1002/pro.70207 PubMed 40545685