Skip to main content

pFloxin-IRES-eGFP
(Plasmid #24557)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24557 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript
  • Backbone size w/o insert (bp) 4557
  • Vector type
    Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Species
    A. victoria
  • Insert Size (bp)
    717

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer tcggtgcacatgctttacat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFloxin-IRES-eGFP was a gift from Jeremy Reiter (Addgene plasmid # 24557 ; http://n2t.net/addgene:24557 ; RRID:Addgene_24557)
  • For your References section:

    Floxin, a resource for genetically engineering mouse ESCs. Singla V, Hunkapiller J, Santos N, Seol AD, Norman AR, Wakenight P, Skarnes WC, Reiter JF. Nat Methods. 2010 Jan . 7(1):50-2. 10.1038/nmeth.1406 PubMed 19966808