Skip to main content

pFloxin-IRES-Ofd1-Myc
(Plasmid #24559)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24559 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript
  • Backbone size w/o insert (bp) 4501
  • Vector type
    Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ofd1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3550
  • GenBank ID
    NM_177429
  • Entrez Gene
    Ofd1 (a.k.a. ORF2, Cxorf5, DXGgc7e)
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site ApaI (destroyed during cloning)
  • 5′ sequencing primer tcggtgcacatgctttacat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also see the following article:
Ofd1, a human disease gene, regulates the length and distal structure of centrioles.

Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF.

Dev Cell. 2010 Mar 16;18(3):410-24.PMID: 20230748

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFloxin-IRES-Ofd1-Myc was a gift from Jeremy Reiter (Addgene plasmid # 24559 ; http://n2t.net/addgene:24559 ; RRID:Addgene_24559)
  • For your References section:

    Floxin, a resource for genetically engineering mouse ESCs. Singla V, Hunkapiller J, Santos N, Seol AD, Norman AR, Wakenight P, Skarnes WC, Reiter JF. Nat Methods. 2010 Jan . 7(1):50-2. 10.1038/nmeth.1406 PubMed 19966808