pICSL12030
(Plasmid
#245637)
-
PurposeLevel 0 Golden Gate part pAt1: Tip Delta (AT3g16240) promoter, GGAG - AATG
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH41295
- Backbone size w/o insert (bp) 2249
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepAt1: Tip Delta (AT3g16240) promoter
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1734
-
MutationBsaI/BpiI sites removed by point-mutation
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TCACATGTTCTTTCCTGCG
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Level 0 promoter + 5' untranslated region module used for GoldenGate assemblies using the MoClo overhang syntax
Please note: This plasmid contains an A/C 50/50 mixed base in pAT1. This is not known to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL12030 was a gift from Mark Youles (Addgene plasmid # 245637 ; http://n2t.net/addgene:245637 ; RRID:Addgene_245637)