pFloxin-IRES-Ofd1-Myc-S75F
(Plasmid
#24574)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 4873
-
Vector typeMouse Targeting, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Growth instructionsStbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOfd1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3087
-
Mutationserine 75 changed to phenylalanine (codon TCT changed to TTT)
-
GenBank IDNM_177429
-
Entrez GeneOfd1 (a.k.a. ORF2, Cxorf5, DXGgc7e)
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tcggtgcacatgctttacat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation reported in:
OFD1, the gene mutated in oral-facial-digital syndrome type 1, is expressed in the metanephros and in human embryonic renal mesenchymal cells.
Romio L, Wright V, Price K, Winyard PJ, Donnai D, Porteous ME, Franco B, Giorgio G, Malcolm S, Woolf AS, Feather SA.
J Am Soc Nephrol. 2003 Mar;14(3):680-9.PMID: 12595504
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFloxin-IRES-Ofd1-Myc-S75F was a gift from Jeremy Reiter (Addgene plasmid # 24574 ; http://n2t.net/addgene:24574 ; RRID:Addgene_24574) -
For your References section:
Ofd1, a human disease gene, regulates the length and distal structure of centrioles. Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF. Dev Cell. 2010 Mar 16. 18(3):410-24. 10.1016/j.devcel.2009.12.022 PubMed 20230748