AAV CAG-FLEx-Rpl22-3xHA
(Plasmid
#245798)
-
PurposeCre-dependent expression of Rpl22-HA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-CAG-FLEX
-
Backbone manufacturerRyohei Yasuda (Addgene #84357)
- Backbone size w/o insert (bp) 5006
- Total vector size (bp) 5495
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRibosomal protein L22
-
Alt nameRpl22
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)489
-
GenBank IDNM_001277113.1
-
Entrez GeneRpl22 (a.k.a. 2700038K18Rik)
- Promoter CAG
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byKhakh Lab, Addgene #111811
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV CAG-FLEx-Rpl22-3xHA was a gift from Baljit Khakh (Addgene plasmid # 245798 ; http://n2t.net/addgene:245798 ; RRID:Addgene_245798)