pYPQ132B-CsALSgR1.1
(Plasmid
#245875)
-
PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHD1
-
Backbone manufacturerCermak et al. 2011
- Total vector size (bp) 3622
-
Vector typePlant Expression, CRISPR ; Golden Gate entry vector to expressing the 1st gRNA
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCsALS_gRNA1.1
-
gRNA/shRNA sequencecaggtccctcggaggatgat
-
SpeciesSynthetic
- Promoter AtU3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer tctgatgttacattgcacaaga
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYPQ132B-CsALSgR1.1 was a gift from Yiping Qi (Addgene plasmid # 245875 ; http://n2t.net/addgene:245875 ; RRID:Addgene_245875) -
For your References section:
Transgene-free genome editing in citrus and poplar trees using positive and negative selection markers. Rocha DC, Omoregbee MO, Contiliani DF, Mandlik R, Li G, Mascoveto J, Coleman G, Culver JN, Leal DR, de Souza AA, Qi Y. Plant Cell Rep. 2025 Oct 22;44(11):244. doi: 10.1007/s00299-025-03627-2. 10.1007/s00299-025-03627-2 PubMed 41123679