Skip to main content

pYPQ133B-TLS-CsALSgR1.2
(Plasmid #245878)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 245878 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHD1
  • Backbone manufacturer
    Cermak et al. 2011
  • Total vector size (bp) 3661
  • Modifications to backbone
    Insertion of TLS2 mobile RNA sequence
  • Vector type
    Plant Expression, CRISPR ; Golden Gate entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CsALSgR1.2
  • gRNA/shRNA sequence
    caggtcccgcggaggatgat
  • Promoter AtU3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer tctgatgttacattgcacaaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Addgene NGS sequence differs from the reference sequence attached: it is missing a section of backbone, but the depositor has confirmed this does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYPQ133B-TLS-CsALSgR1.2 was a gift from Yiping Qi (Addgene plasmid # 245878 ; http://n2t.net/addgene:245878 ; RRID:Addgene_245878)
  • For your References section:

    Transgene-free genome editing in citrus and poplar trees using positive and negative selection markers. Rocha DC, Omoregbee MO, Contiliani DF, Mandlik R, Li G, Mascoveto J, Coleman G, Culver JN, Leal DR, de Souza AA, Qi Y. Plant Cell Rep. 2025 Oct 22;44(11):244. doi: 10.1007/s00299-025-03627-2. 10.1007/s00299-025-03627-2 PubMed 41123679